-
Tytuł:
-
[Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome].
-
Autorzy:
-
Tao Z; Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, Sichuan 640000, China. .
Lu F
-
Źródło:
-
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics [Zhonghua Yi Xue Yi Chuan Xue Za Zhi] 2021 Jan 10; Vol. 38 (1), pp. 42-46.
-
Typ publikacji:
-
Case Reports; Journal Article
-
Język:
-
Chinese
-
Imprint Name(s):
-
Publication: <2004->: Chengdu, Sichuan, P.R. China : Sichuan University
Original Publication: Chengdu : Hua xi yi ke da xue,
-
MeSH Terms:
-
CHARGE Syndrome*/genetics
DNA Helicases*/genetics
DNA-Binding Proteins*/genetics
Genetic Variation*
Child ; Humans ; Mutation ; Phenotype
-
Substance Nomenclature:
-
0 (DNA-Binding Proteins)
EC 3.6.4.- (DNA Helicases)
EC 3.6.4.12 (CHD7 protein, human)
-
Entry Date(s):
-
Date Created: 20210110 Date Completed: 20210125 Latest Revision: 20210125
-
Update Code:
-
20240105
-
DOI:
-
10.3760/cma.j.cn511374-20200622-00461
-
PMID:
-
33423256
-
Objective: To explore the genetic basis for three children patients with CHARGE syndrome.
Methods: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
Results: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.
Conclusion: Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
